Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: C57epi cells infected with C. muridarum induced the activation of the UPR transducers [PERK (1A), IRE1α (1B) and ATF6α (1C)]. A, Ten μg total protein from cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against phosphorylated PERK or phosphorylated IRE1α or ATF6α. Lane 1: protein molecular weight marker. Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. B, Bar chart of phosphorylated PERK (A), phosphorylated IRE1α (B), and ATF6α (C) intensity, showing the level of activation at the different MOIs and times postinfection (white bars: noninfected; black bars: MoPn [MOI 1] infected; hatched bars: MoPn [MOI 5] infected). Abbreviations: ATF6α, activating transcription factor-6α; C57epi cells, mouse oviduct epithelial cells; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; NI, noninfected; PERK, protein kinase RNA-activated–like ER kinase; UPR, unfolded protein response.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Infection, Activation Assay, Western Blot, Molecular Weight, Marker

Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: A, The mRNA of XBP1 is spliced by the endonuclease activity of IRE1α. Total RNA was extracted from C57epi cells cultured in various experimental conditions. Primer pair (forward: 5’-GAACCAGGAGTTAAGAACACG -3’; reverse: 5’AGGCAACAGTGTCAGAGTCC -3’) was used in PCR amplification. The DNA template was the complementary DNA reverse transcribed from the RNA extracted from each culture condition. The PCR product from each culture condition was ran on 2% agarose gel and stained with ethidium bromide. Lane 1: molecular weight marker. Lane 2: noninfected C57epi cells cultured for 48 hours showing the presence of unspliced 205-bp band used as negative control. Lane 3: C57epi cells infected with C. muridarum (MoPn) at MOI 5 for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band. Lane 4: C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. Lane 5: Noninfected C57epi cells treated with thapsigargin (chemical inducer of UPR) cultured for 48 hours showing the presence of unspliced 205-bp band as well as spliced 179-bp band used as positive control. Lanes 6–8: PCR amplification of GAPDH gene products used as loading control for noninfected C57epi cells infected with MoPn at MOI 5 and C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours showing the presence of unspliced 205-bp band. B, C57epi cells infected with C. muridarum induced the upregulation of XBP1 protein and inhibition of IRE1α RNase activity results in the downregulation of XBP1. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum for 48 hours and treated/nontreated with inhibitor of IRE1α RNase activity were prepared for Western blot analysis. Blot was probed with primary antibody against spliced XBP1. Lane 1: protein molecular weight marker. Lane 2 sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours. Lane 4: sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours. C, Western blot of eIF2α phosphorylation during Chlamydia infection. Ten μg total protein from C57epi cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against phosphorylated eIF2α. Lane 1: protein molecular weight marker. Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. Abbreviations: bp, base pairs; C57epi cells, mouse oviduct epithelial cells; eIF2α, eukaryotic initiation factor 2-α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; mRNA, messenger RNA; NI, noninfected; PCR, polymerase chain reaction; RNase, ribonuclease; Thap, thapsigargin; XBP1, X-box binding protein 1.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Activity Assay, Cell Culture, Amplification, Reverse Transcription, Agarose Gel Electrophoresis, Staining, Molecular Weight, Marker, Negative Control, Infection, Positive Control, Control, Inhibition, Western Blot, Phospho-proteomics, Polymerase Chain Reaction, Binding Assay

Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: A, Images of Western blot analysis of hexokinase II expression during Chlamydia infection. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum (MoPn) for 48 hours and treated/nontreated with inhibitor of PERK kinase activity were prepared for Western blot analysis. Blot was probed with primary antibody against hexokinase II. Lane 1: protein molecular weight marker. Lane 2: sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours. Lane 4: sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of PERK kinase activity for 48 hours. B, Images of Western blot analysis of Glut1 and hexokinase II expression during Chlamydia infection. C57epi cells infected with C. muridarum (MoPn) induced the upregulation of key proteins in the IRE1α arm of UPR pathways, including Glut1 and hexokinase II, and the inhibition of IRE1α RNase activity, resulting in their downregulation. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum for 48 hours and treated/nontreated with inhibitor of IRE1α RNase activity were prepared for Western blot analysis. Blot was probed with primary antibody against Glut1 or hexokinase II. Lane 1: protein molecular weight marker. Lane 2 sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours. Lane 4: sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours. Abbreviations: C57epi cells, mouse oviduct epithelial cells; Glut1, glucose transporter-1; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; NI, noninfected; PERK, protein kinase RNA-activated–like ER kinase; RNase, ribonuclease; UPR, unfolded protein response.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Western Blot, Expressing, Infection, Activity Assay, Molecular Weight, Marker, Inhibition

Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: A, Bar chart of lipid content of C. muridarum MoPn infected and noninfected C57epi cells. The infection of C57epi cells with MoPn (MOI 5) resulted in phospholipid upregulation as measured by the increase in choline content of infected and noninfected cells. B, Western blot analysis of ATF4 activation during Chlamydia infection. Ten μg total protein from C57epi cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against ATF4. Lane 1: protein molecular weight marker; Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. Abbreviations: ATF4, activating transcription factor 4; C57epi cells, mouse oviduct epithelial cells; MOI, multiplicity of infection; MoPn, mouse pneumonitis; NI, noninfected.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Infection, Western Blot, Activation Assay, Molecular Weight, Marker

Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: A, Images of Western blot analysis of c-Jun and MAP-LC3β expression during Chlamydial infection. C57epi cells infected with C. muridarum (MoPn) induced the upregulation of key proteins in the UPR pathways, including c-Jun and MAP-LC3β and inhibition of IRE1 RNase activity result in their downregulation. Ten μg total protein from C57epi cells uninfected/infected with C. muridarum for 48 hours and treated/nontreated with inhibitor of IRE1α RNase activity were prepared for Western blot analysis. Blot was probed with primary antibody against c-Jun, Glut1, hexokinase II, and MAP-LC3β. Lane 1: protein molecular weight marker. Lane 2: sample from noninfected C57epi cells at 48 hours. Lane 3: sample from C57epi cells infected with MoPn at MOI 5 for 48 hours; Lane 4: Sample from C57epi cells infected with MoPn at MOI 5 in the presence of inhibitor of IRE1α RNase activity for 48 hours. B, Western blot of MAP-LC3β. Ten μg total protein from cells infected with C. muridarum (MoPn) for 24, 48, and 72 hours were prepared for Western blot analysis. Blot was probed with primary antibody against MAP-LC3β. Lane 1: protein molecular weight marker. Lanes 2–4: samples from noninfected C57epi cells at 24, 48, and 72 hours. Lanes 5–7: samples from C57epi cells infected with C. muridarum (MOI 1) at 24, 48, and 72 hours. Lanes 8–10: samples from C57epi cells infected with C. muridarum (MOI 5) at 24, 48, and 72 hours. Abbreviations: C57epi cells, mouse oviduct epithelial cells; Glut1, glucose transporter-1; IRE1α, inositol-requiring enzyme-1α; MAP-LC3β, microtubule-associated protein 1 light chain 3; MOI, multiplicity of infection; MoPn, mouse pneumonitis; NI, noninfected; RNase, ribonuclease.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Western Blot, Expressing, Infection, Inhibition, Activity Assay, Molecular Weight, Marker

Journal: The Journal of Infectious Diseases

Article Title: The Roles of Unfolded Protein Response Pathways in Chlamydia Pathogenesis

doi: 10.1093/infdis/jiw569

Figure Lengend Snippet: Role of the IRE1α and PERK signaling pathways of UPR in Chlamydia replication in vitro. Fluorescence microscope images and bar chart of MoPn infectious-forming units recovered from C57epi cells treated with or without IRE1α RNase or PERK inhibitors. A, Fluorescence microscope images of noninfected C57epi cells (A1), C57epi cells infected with MoPn (A2), and C57epi cells infected with MoPn and treated with IRE1α RNase (A3) or PERK kinase (A4) inhibitor. B, Bar chart of MoPn infectious-forming units recovered per slide of noninfected, MoPn (MOI 5)–infected, and MoPn (MOI 5)–infected/treatment with IRE1α RNase or PERK kinase inhibitors. All cultures were incubated for 48 hours. Abbreviations: C57epi cells, mouse oviduct epithelial cells; IRE1α, inositol-requiring enzyme-1α; MOI, multiplicity of infection; MoPn, mouse pneumonitis; NI, noninfected; PERK, protein kinase RNA-activated–like ER kinase; RNase, ribonuclease; UPR, unfolded protein response.

Article Snippet: Mammalian cells were mouse oviduct epithelial cells (C57epi.1) kindly provided by Dr Raymond Johnson (Indiana Univ., Indianapolis, IN).

Techniques: Protein-Protein interactions, In Vitro, Fluorescence, Microscopy, Infection, Incubation